Sequence retrieval

Genome: Parachlamydia acanthamoebae UV7
Start position: 616028
End position: 616051
Length: 24

DNA sequence
>NC_015702, from 616028 to 616051 (24 bp); Parachlamydia acanthamoebae UV7 GAAGATGAAGACGAGGATGAAGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 615081-616454	Sequence	PUV_05690 sctQ, cdsQ type III secretion basal body protein