Sequence retrieval

Genome: Parachlamydia acanthamoebae UV7
Start position: 2799987
End position: 2800010
Length: 24

DNA sequence
>NC_015702, from 2799987 to 2800010 (24 bp); Parachlamydia acanthamoebae UV7 AAATCAAATTCATAATCAAAATCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2798127-2800637	Sequence	PUV_25540 - hypothetical protein (Protein is coded in complementary strand; from 2800637 to 2798127)