Sequence retrieval

Genome: Parachlamydia acanthamoebae UV7
Start position: 2353367
End position: 2353390
Length: 24

DNA sequence
>NC_015702, from 2353367 to 2353390 (24 bp); Parachlamydia acanthamoebae UV7 AAAAATAGAAACATAGAAAAATAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2351570-2353432	Sequence	PUV_21250 - hypothetical protein (Protein is coded in complementary strand; from 2353432 to 2351570)