Sequence retrieval

Genome: Parachlamydia acanthamoebae UV7
Start position: 2195840
End position: 2195863
Length: 24

DNA sequence
>NC_015702, from 2195840 to 2195863 (24 bp); Parachlamydia acanthamoebae UV7 CAGCTGCTGCTGGAGCTGCTGCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2195617-2196003	Sequence	PUV_19820 rpLL 50S ribosomal protein L7/L12 (Protein is coded in complementary strand; from 2196003 to 2195617)