Sequence retrieval

Genome: Parachlamydia acanthamoebae UV7
Start position: 2065964
End position: 2065987
Length: 24

DNA sequence
>NC_015702, from 2065964 to 2065987 (24 bp); Parachlamydia acanthamoebae UV7 ATTCAGAGTCAGAATCAGTTTCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2065897-2067498	Sequence	PUV_18700 - hypothetical protein (Protein is coded in complementary strand; from 2067498 to 2065897)