Sequence retrieval

Genome: Parachlamydia acanthamoebae UV7
Start position: 1825594
End position: 1825617
Length: 24

DNA sequence
>NC_015702, from 1825594 to 1825617 (24 bp); Parachlamydia acanthamoebae UV7 TGCTGTTGTTGTTGCTGCTGCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1824880-1826628	Sequence	PUV_16220 - hypothetical protein (Protein is coded in complementary strand; from 1826628 to 1824880)