Sequence retrieval

Genome: Ramlibacter tataouinensis TTB310
Start position: 940165
End position: 940189
Length: 25

DNA sequence
>NC_015677, from 940165 to 940189 (25 bp); Ramlibacter tataouinensis TTB310 CCGCGACGCGCAGCGCCGCGGCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 940146-940910	Sequence	Rta_09060 - 2-pyrone-4,6-dicarboxylic acid hydrolase (Protein is coded in complementary strand; from 940910 to 940146)