Sequence retrieval

Genome: Ramlibacter tataouinensis TTB310
Start position: 864391
End position: 864414
Length: 24

DNA sequence
>NC_015677, from 864391 to 864414 (24 bp); Ramlibacter tataouinensis TTB310 TCGCCGTCGCCGTCGTCGCCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 864295-865083	Sequence	Rta_08360 - Sec independent protein secretion pathway, subunit TatC