Sequence retrieval

Genome: Ramlibacter tataouinensis TTB310
Start position: 768053
End position: 768076
Length: 24

DNA sequence
>NC_015677, from 768053 to 768076 (24 bp); Ramlibacter tataouinensis TTB310 CGGCCAGCCAGCCAGCGGGCCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 767279-768190	Sequence	Rta_07370 dapA dihydrodipicolinate synthase (Protein is coded in complementary strand; from 768190 to 767279)