Sequence retrieval

Genome: Ramlibacter tataouinensis TTB310
Start position: 748434
End position: 748457
Length: 24

DNA sequence
>NC_015677, from 748434 to 748457 (24 bp); Ramlibacter tataouinensis TTB310 GGTGCCGGTGCCGGCGCCGGTGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 747976-749163	Sequence	Rta_07170 - hypothetical protein (Protein is coded in complementary strand; from 749163 to 747976)