Sequence retrieval

Genome: Ramlibacter tataouinensis TTB310
Start position: 561857
End position: 561880
Length: 24

DNA sequence
>NC_015677, from 561857 to 561880 (24 bp); Ramlibacter tataouinensis TTB310 GCGGCCGCGCCCGCTGCCGCGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 561480-563204	Sequence	Rta_05430 - cardiolipin synthetase (Protein is coded in complementary strand; from 563204 to 561480)