Sequence retrieval

Genome: Ramlibacter tataouinensis TTB310
Start position: 527951
End position: 527974
Length: 24

DNA sequence
>NC_015677, from 527951 to 527974 (24 bp); Ramlibacter tataouinensis TTB310 CGGCCGCGGGCGCCGCCGTGGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 526678-528768	Sequence	Rta_05080 - thiol:disulfide reductase (Protein is coded in complementary strand; from 528768 to 526678)