Sequence retrieval

Genome: Ramlibacter tataouinensis TTB310
Start position: 442070
End position: 442093
Length: 24

DNA sequence
>NC_015677, from 442070 to 442093 (24 bp); Ramlibacter tataouinensis TTB310 GACCAGGGCCAGGCCCAGGCCCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 441561-443282	Sequence	Rta_04360 - hybrid histidine kinase (Protein is coded in complementary strand; from 443282 to 441561)