Sequence retrieval

Genome: Ramlibacter tataouinensis TTB310
Start position: 3994030
End position: 3994053
Length: 24

DNA sequence
>NC_015677, from 3994030 to 3994053 (24 bp); Ramlibacter tataouinensis TTB310 CGGCCACCGCCACGCCCACCGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3993540-3994322	Sequence	Rta_37510 birA bifunctional Biotin operon transcriptional regulator/Biotin-- [acetyl-CoA-carboxylase] synthetase (Protein is coded in complementary strand; from 3994322 to 3993540)