Sequence retrieval

Genome: Ramlibacter tataouinensis TTB310
Start position: 3925707
End position: 3925736
Length: 30

DNA sequence
>NC_015677, from 3925707 to 3925736 (30 bp); Ramlibacter tataouinensis TTB310 GCGCTGGCCAGCGCCGGCGAGGGCTGGCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3924321-3926765	Sequence	Rta_36950 - hypothetical protein (Protein is coded in complementary strand; from 3926765 to 3924321)