Sequence retrieval

Genome: Ramlibacter tataouinensis TTB310
Start position: 3518796
End position: 3518831
Length: 36

DNA sequence
>NC_015677, from 3518796 to 3518831 (36 bp); Ramlibacter tataouinensis TTB310 CAGGTCGGCGCCCAGGTTGGCGACCAGGTCGTCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3518554-3520176	Sequence	Rta_33070 katE hydroperoxidase II (Protein is coded in complementary strand; from 3520176 to 3518554)