Sequence retrieval

Genome: Ramlibacter tataouinensis TTB310
Start position: 3462397
End position: 3462426
Length: 30

DNA sequence
>NC_015677, from 3462397 to 3462426 (30 bp); Ramlibacter tataouinensis TTB310 CGCGGCGCTGCGCGCCGAGGCGCCGCGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3462051-3463031	Sequence	Rta_32520 - LysR family transcriptional regulator