Sequence retrieval

Genome: Ramlibacter tataouinensis TTB310
Start position: 3327873
End position: 3327899
Length: 27

DNA sequence
>NC_015677, from 3327873 to 3327899 (27 bp); Ramlibacter tataouinensis TTB310 ATCACCAGCATCACCACCAGCACCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3327234-3328316	Sequence	Rta_31220 - hypothetical protein (Protein is coded in complementary strand; from 3328316 to 3327234)