Sequence retrieval

Genome: Ramlibacter tataouinensis TTB310
Start position: 3314618
End position: 3314641
Length: 24

DNA sequence
>NC_015677, from 3314618 to 3314641 (24 bp); Ramlibacter tataouinensis TTB310 GGCCTCGGCCTGGCCCTCGGGCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3314238-3316010	Sequence	Rta_31080 - ATP-dependent DNA ligase (Protein is coded in complementary strand; from 3316010 to 3314238)