Sequence retrieval

Genome: Ramlibacter tataouinensis TTB310
Start position: 3237865
End position: 3237888
Length: 24

DNA sequence
>NC_015677, from 3237865 to 3237888 (24 bp); Ramlibacter tataouinensis TTB310 GCCACGGCCAGGGTCACGGCCACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3235447-3237993	Sequence	Rta_30400 - putative ABC transporter involved in lysophospholipase L1 biosynthesis, permease with duplicated domains (Protein is coded in complementary strand; from 3237993 to 3235447)