Sequence retrieval

Genome: Ramlibacter tataouinensis TTB310
Start position: 3214589
End position: 3214615
Length: 27

DNA sequence
>NC_015677, from 3214589 to 3214615 (27 bp); Ramlibacter tataouinensis TTB310 GGCCACCGCGGCCGCCGCGGCCAGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3213786-3215183	Sequence	Rta_30150 - ABC transporter permease (Protein is coded in complementary strand; from 3215183 to 3213786)