Sequence retrieval

Genome: Ramlibacter tataouinensis TTB310
Start position: 3100073
End position: 3100099
Length: 27

DNA sequence
>NC_015677, from 3100073 to 3100099 (27 bp); Ramlibacter tataouinensis TTB310 CGTGGCCGCCGCGGCCGCCGTCGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3099139-3100233	Sequence	Rta_29100 obg Spo0B-associated GTP-binding protein (Protein is coded in complementary strand; from 3100233 to 3099139)