Sequence retrieval

Genome: Ramlibacter tataouinensis TTB310
Start position: 3062658
End position: 3062681
Length: 24

DNA sequence
>NC_015677, from 3062658 to 3062681 (24 bp); Ramlibacter tataouinensis TTB310 CAGCGCCTGCGCCAGCGCCAGCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3062134-3062874	Sequence	Rta_28750 - response regulator LytTR (Protein is coded in complementary strand; from 3062874 to 3062134)