Sequence retrieval

Genome: Ramlibacter tataouinensis TTB310
Start position: 2922281
End position: 2922310
Length: 30

DNA sequence
>NC_015677, from 2922281 to 2922310 (30 bp); Ramlibacter tataouinensis TTB310 CGGCGCCTGGCGGCGCGCGGCGGCGCCTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2921491-2922327	Sequence	Rta_27500 - AraC family transcriptional regulator