Sequence retrieval

Genome: Ramlibacter tataouinensis TTB310
Start position: 2869978
End position: 2870040
Length: 63

DNA sequence
>NC_015677, from 2869978 to 2870040 (63 bp); Ramlibacter tataouinensis TTB310 GCGCATAGACCGGCGCCGGCTGCACGTAGACCGGGGCGGGCTGCACATAGACGGGAGCCGGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2869719-2870213	Sequence	Rta_26970 - hypothetical protein (Protein is coded in complementary strand; from 2870213 to 2869719)