Sequence retrieval

Genome: Ramlibacter tataouinensis TTB310
Start position: 2801880
End position: 2801906
Length: 27

DNA sequence
>NC_015677, from 2801880 to 2801906 (27 bp); Ramlibacter tataouinensis TTB310 GACGGCGAAGGCGGCGAAGAAGGCGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2801062-2802537	Sequence	Rta_26310 nuoM NADH:ubiquinone oxidoreductase subunit 13 or 4, chain M (Protein is coded in complementary strand; from 2802537 to 2801062)