Sequence retrieval

Genome: Ramlibacter tataouinensis TTB310
Start position: 2743473
End position: 2743496
Length: 24

DNA sequence
>NC_015677, from 2743473 to 2743496 (24 bp); Ramlibacter tataouinensis TTB310 GCGGCGGCGGCAGCGGAGGCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2743374-2743637	Sequence	Rta_25725 - outer membrane protein (Protein is coded in complementary strand; from 2743637 to 2743374)