Sequence retrieval

Genome: Ramlibacter tataouinensis TTB310
Start position: 2650418
End position: 2650441
Length: 24

DNA sequence
>NC_015677, from 2650418 to 2650441 (24 bp); Ramlibacter tataouinensis TTB310 GCCGCCACCGCCGCCACCGCCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2649441-2650748	Sequence	Rta_24960 - hypothetical protein (Protein is coded in complementary strand; from 2650748 to 2649441)