Sequence retrieval

Genome: Ramlibacter tataouinensis TTB310
Start position: 2625507
End position: 2625530
Length: 24

DNA sequence
>NC_015677, from 2625507 to 2625530 (24 bp); Ramlibacter tataouinensis TTB310 GCCGCCGCCGACGCCGCCGCTGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2625382-2626704	Sequence	Rta_24720 - Glutamate carboxypeptidase (Protein is coded in complementary strand; from 2626704 to 2625382)