Sequence retrieval

Genome: Ramlibacter tataouinensis TTB310
Start position: 2561136
End position: 2561162
Length: 27

DNA sequence
>NC_015677, from 2561136 to 2561162 (27 bp); Ramlibacter tataouinensis TTB310 TCACCAGGATCACCAGGAACACCAGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2560874-2562571	Sequence	Rta_24140 - transporter (Protein is coded in complementary strand; from 2562571 to 2560874)