Sequence retrieval

Genome: Ramlibacter tataouinensis TTB310
Start position: 2471100
End position: 2471126
Length: 27

DNA sequence
>NC_015677, from 2471100 to 2471126 (27 bp); Ramlibacter tataouinensis TTB310 CGGCCGCCGCAGCCGCCGCGGCCACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2470118-2471176	Sequence	Rta_23260 - nitrate/sulfonate/bicarbonate ABC transporter periplasmic protein (Protein is coded in complementary strand; from 2471176 to 2470118)