Sequence retrieval

Genome: Ramlibacter tataouinensis TTB310
Start position: 2418986
End position: 2419015
Length: 30

DNA sequence
>NC_015677, from 2418986 to 2419015 (30 bp); Ramlibacter tataouinensis TTB310 ATGGTGATGGTCAGGGTGACGGTGCTGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2405717-2428102	Sequence	Rta_22840 - hypothetical protein (Protein is coded in complementary strand; from 2428102 to 2405717)