Sequence retrieval

Genome: Ramlibacter tataouinensis TTB310
Start position: 2352759
End position: 2352782
Length: 24

DNA sequence
>NC_015677, from 2352759 to 2352782 (24 bp); Ramlibacter tataouinensis TTB310 GCTGCCGCTGCGGGTGCCGCTGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2352631-2353257	Sequence	Rta_22290 - hypothetical protein (Protein is coded in complementary strand; from 2353257 to 2352631)