Sequence retrieval

Genome: Ramlibacter tataouinensis TTB310
Start position: 2307117
End position: 2307143
Length: 27

DNA sequence
>NC_015677, from 2307117 to 2307143 (27 bp); Ramlibacter tataouinensis TTB310 TTCCTTGTGTTCCTTGTGTTCCTTGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2306527-2307273	Sequence	Rta_21800 - hypothetical protein (Protein is coded in complementary strand; from 2307273 to 2306527)