Sequence retrieval

Genome: Ramlibacter tataouinensis TTB310
Start position: 2298495
End position: 2298539
Length: 45

DNA sequence
>NC_015677, from 2298495 to 2298539 (45 bp); Ramlibacter tataouinensis TTB310 CATGTCCGGCAGGCCCAGGTCCAGCAGGCACACGTCCGGCGGGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2298301-2300253	Sequence	Rta_21730 - hybrid histidine kinase (Protein is coded in complementary strand; from 2300253 to 2298301)