Sequence retrieval

Genome: Ramlibacter tataouinensis TTB310
Start position: 2295480
End position: 2295503
Length: 24

DNA sequence
>NC_015677, from 2295480 to 2295503 (24 bp); Ramlibacter tataouinensis TTB310 GCAGGCGCGGGCGCAGGCGCACGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2295137-2296333	Sequence	Rta_21700 - formyl-coenzyme A transferase (Protein is coded in complementary strand; from 2296333 to 2295137)