Sequence retrieval

Genome: Ramlibacter tataouinensis TTB310
Start position: 2093001
End position: 2093024
Length: 24

DNA sequence
>NC_015677, from 2093001 to 2093024 (24 bp); Ramlibacter tataouinensis TTB310 GGCCAGGGCCAGGTCCAGCGCCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2092135-2093124	Sequence	Rta_19830 holB DNA polymerase III subunit delta' (Protein is coded in complementary strand; from 2093124 to 2092135)