Sequence retrieval

Genome: Ramlibacter tataouinensis TTB310
Start position: 1944730
End position: 1944753
Length: 24

DNA sequence
>NC_015677, from 1944730 to 1944753 (24 bp); Ramlibacter tataouinensis TTB310 CGCCAGCGCCCGGGCCAGCTCCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1944431-1945192	Sequence	Rta_18500 - branched chain amino acid ABC transporter ATP-binding protein (Protein is coded in complementary strand; from 1945192 to 1944431)