Sequence retrieval

Genome: Ramlibacter tataouinensis TTB310
Start position: 1768068
End position: 1768091
Length: 24

DNA sequence
>NC_015677, from 1768068 to 1768091 (24 bp); Ramlibacter tataouinensis TTB310 CAGGGCCAGGGCCTGGGCCACGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1767931-1768899	Sequence	Rta_16760 tctC extracytoplasmic binding receptor (Protein is coded in complementary strand; from 1768899 to 1767931)