Sequence retrieval

Genome: Ramlibacter tataouinensis TTB310
Start position: 1641349
End position: 1641372
Length: 24

DNA sequence
>NC_015677, from 1641349 to 1641372 (24 bp); Ramlibacter tataouinensis TTB310 GCGCTGGTGCTGGTGCTGGCCCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1640780-1641910	Sequence	Rta_15670 - branched chain amino acid ABC transporter permease