Sequence retrieval

Genome: Ramlibacter tataouinensis TTB310
Start position: 1587722
End position: 1587745
Length: 24

DNA sequence
>NC_015677, from 1587722 to 1587745 (24 bp); Ramlibacter tataouinensis TTB310 CGGCGGCGGGGGAGGCGGCGCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1587084-1587926	Sequence	Rta_15140 tolA tolA protein (Protein is coded in complementary strand; from 1587926 to 1587084)