Sequence retrieval

Genome: Ramlibacter tataouinensis TTB310
Start position: 1422220
End position: 1422244
Length: 25

DNA sequence
>NC_015677, from 1422220 to 1422244 (25 bp); Ramlibacter tataouinensis TTB310 CGGGGCCGGGCGGTGCTGGGCGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1421731-1422861	Sequence	Rta_13610 - hypothetical protein (Protein is coded in complementary strand; from 1422861 to 1421731)