Sequence retrieval

Genome: Ramlibacter tataouinensis TTB310
Start position: 1352488
End position: 1352511
Length: 24

DNA sequence
>NC_015677, from 1352488 to 1352511 (24 bp); Ramlibacter tataouinensis TTB310 CACCGGCACCGGCACCGGCACCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1352102-1352611	Sequence	Rta_13020 - hypothetical protein (Protein is coded in complementary strand; from 1352611 to 1352102)