Sequence retrieval

Genome: Ramlibacter tataouinensis TTB310
Start position: 125288
End position: 125317
Length: 30

DNA sequence
>NC_015677, from 125288 to 125317 (30 bp); Ramlibacter tataouinensis TTB310 CGCGCGCGCCCACGCGCACCCGCGCCAGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 125083-126291	Sequence	Rta_01290 - threonine dehydratase (Protein is coded in complementary strand; from 126291 to 125083)