Sequence retrieval

Genome: Ramlibacter tataouinensis TTB310
Start position: 1190484
End position: 1190510
Length: 27

DNA sequence
>NC_015677, from 1190484 to 1190510 (27 bp); Ramlibacter tataouinensis TTB310 TGGCCGTTGTAGCCGTTGTGGCCGTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1190142-1191962	Sequence	Rta_11560 rhlE1 ATP-dependent RNA helicase (Protein is coded in complementary strand; from 1191962 to 1190142)