Sequence retrieval

Genome: Buchnera aphidicola (Cinara tujafilina)
Start position: 230395
End position: 230427
Length: 33

DNA sequence
>NC_015662, from 230395 to 230427 (33 bp); Buchnera aphidicola (Cinara tujafilina) TTTTTTTTCTATTTTTTTTGTATTTTTTTTCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 228647-230707	Sequence	BCTU_190 mfd transcription-repair coupling factor (Protein is coded in complementary strand; from 230707 to 228647)