Sequence retrieval

Genome: Buchnera aphidicola (Cinara tujafilina)
Start position: 111272
End position: 111296
Length: 25

DNA sequence
>NC_015662, from 111272 to 111296 (25 bp); Buchnera aphidicola (Cinara tujafilina) TTTTTTCTTTTTTTATTTTTTTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 110950-113811	Sequence	BCTU_097 ileS isoleucyl-tRNA synthetase (Protein is coded in complementary strand; from 113811 to 110950)