Sequence retrieval

Genome: Geobacillus thermoglucosidasius C56-YS93
Start position: 3325035
End position: 3325070
Length: 36

DNA sequence
>NC_015660, from 3325035 to 3325070 (36 bp); Geobacillus thermoglucosidasius C56-YS93 TGCCCAAAACATTGCCCAAAACATTGCCCAAAACAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3324996-3325274	Sequence	Geoth_3411 - putative heterocycle-containing bacteriocin (Protein is coded in complementary strand; from 3325274 to 3324996)