Sequence retrieval

Genome: Bacillus coagulans 2-6
Start position: 2998927
End position: 2998971
Length: 45

DNA sequence
>NC_015634, from 2998927 to 2998971 (45 bp); Bacillus coagulans 2-6 GATCTTCATCATCATGATCGTCATCGTCGTGATCCTGATCATCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2997864-2999315	Sequence	BCO26_2912 - transposase IS4 family protein (Protein is coded in complementary strand; from 2999315 to 2997864)