Sequence retrieval

Genome: Bacillus coagulans 2-6
Start position: 2792628
End position: 2792672
Length: 45

DNA sequence
>NC_015634, from 2792628 to 2792672 (45 bp); Bacillus coagulans 2-6 GATCTTCATCATCATGATCGTCATCGTCGTGATCCTGATCATCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2791571-2793118	Sequence	BCO26_2713 - transposase IS4 family protein (Protein is coded in complementary strand; from 2793118 to 2791571)